|
Left Crispr |
Right Crispr |
| Crispr ID |
906563579 |
906563586 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:46778980-46779002
|
1:46779014-46779036
|
| Sequence |
CCTCAAGTGCTGCCAAAGTGGGA |
GGAGGCACAGAGAGTGAGCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 87, 1: 528, 2: 340, 3: 287, 4: 393} |
{0: 2, 1: 19, 2: 106, 3: 396, 4: 1305} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|