ID: 906571221_906571226

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 906571221 906571226
Species Human (GRCh38) Human (GRCh38)
Location 1:46843099-46843121 1:46843144-46843166
Sequence CCCTTCGCAGTGGAAGTCAGCTT GGGTTTCACCAGATCCAGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 41, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!