ID: 906573467_906573468

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 906573467 906573468
Species Human (GRCh38) Human (GRCh38)
Location 1:46865204-46865226 1:46865221-46865243
Sequence CCAACTCTCAGCTTTAGACAGGC ACAGGCCATCTAGACAAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 559} {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!