ID: 906581073_906581077

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 906581073 906581077
Species Human (GRCh38) Human (GRCh38)
Location 1:46935497-46935519 1:46935527-46935549
Sequence CCTGCAGCTGGAGGGTTGTCACT CCACCTGGATGCTGCCCTGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 158} {0: 2, 1: 0, 2: 2, 3: 24, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!