ID: 906614533_906614542

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 906614533 906614542
Species Human (GRCh38) Human (GRCh38)
Location 1:47225446-47225468 1:47225481-47225503
Sequence CCGAGAGAGGCCAGCGGCTGGCT CAGCGCGCGGCCGGGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 213} {0: 1, 1: 1, 2: 10, 3: 123, 4: 1110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!