ID: 906636975_906636984

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 906636975 906636984
Species Human (GRCh38) Human (GRCh38)
Location 1:47416385-47416407 1:47416411-47416433
Sequence CCGTCGGGGCCGCCGCCGTCGCC CGCAGGAGCCGAGCCAGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 121, 4: 1678} {0: 1, 1: 0, 2: 2, 3: 46, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!