ID: 906637078_906637093

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 906637078 906637093
Species Human (GRCh38) Human (GRCh38)
Location 1:47416845-47416867 1:47416894-47416916
Sequence CCGCGGCGCCAGGGCCGCCGCTC CGCGCCCGGCCCCGCGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 272} {0: 1, 1: 0, 2: 8, 3: 47, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!