ID: 906639424_906639434

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 906639424 906639434
Species Human (GRCh38) Human (GRCh38)
Location 1:47432839-47432861 1:47432885-47432907
Sequence CCAATTCAGGGCCCGGAAGGGCG GCCAGCAGGCGGCGTGTAATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!