ID: 906689237_906689240

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 906689237 906689240
Species Human (GRCh38) Human (GRCh38)
Location 1:47781756-47781778 1:47781769-47781791
Sequence CCCATGTGGCCTGTGCCCCAGAA TGCCCCAGAACTGTGTAATGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 305} {0: 1, 1: 0, 2: 2, 3: 14, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!