ID: 906700173_906700183

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 906700173 906700183
Species Human (GRCh38) Human (GRCh38)
Location 1:47852115-47852137 1:47852134-47852156
Sequence CCAAACCCAAACACCCACCAGCC AGCCACCGCCATGGGCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 389} {0: 1, 1: 0, 2: 2, 3: 29, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!