ID: 906708319_906708330

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 906708319 906708330
Species Human (GRCh38) Human (GRCh38)
Location 1:47910960-47910982 1:47911002-47911024
Sequence CCTTGCCCAAGGCTGGAATGGCC CTTTGATCGGAGGCAATTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 200} {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!