ID: 906713964_906713972

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 906713964 906713972
Species Human (GRCh38) Human (GRCh38)
Location 1:47953172-47953194 1:47953215-47953237
Sequence CCGAGAGCACCAGGCATGCAGGT GATGATGCACAGAGGGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 257} {0: 1, 1: 0, 2: 1, 3: 17, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!