ID: 906719701_906719710

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 906719701 906719710
Species Human (GRCh38) Human (GRCh38)
Location 1:47996567-47996589 1:47996606-47996628
Sequence CCGGGGGGTGGAGGTGGAGCGGG CGGAAGCAGGACCCAAACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 92, 4: 1033} {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!