ID: 906727614_906727617

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 906727614 906727617
Species Human (GRCh38) Human (GRCh38)
Location 1:48055361-48055383 1:48055388-48055410
Sequence CCAGTCAGAAGCAGCATCTGGTA TCCCAGGCTGGACATGAGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 36, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!