ID: 906734397_906734400

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 906734397 906734400
Species Human (GRCh38) Human (GRCh38)
Location 1:48110687-48110709 1:48110731-48110753
Sequence CCTGAACAAAGAGAAGGAACCAG TCCAAGGAAACTACAGTTAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!