|
Left Crispr |
Right Crispr |
| Crispr ID |
906760568 |
906760571 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:48373410-48373432
|
1:48373437-48373459
|
| Sequence |
CCCATATCGCTATCAGAATTTTT |
AAGCCATTCAACAAGTCACTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 60, 4: 241} |
{0: 8, 1: 1473, 2: 1903, 3: 1423, 4: 1073} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|