ID: 906773574_906773576

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 906773574 906773576
Species Human (GRCh38) Human (GRCh38)
Location 1:48507778-48507800 1:48507802-48507824
Sequence CCTAATTTCTTTTCATGAGAAAT GTGTTTTAAGACCACCTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 708} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!