ID: 906781614_906781617

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 906781614 906781617
Species Human (GRCh38) Human (GRCh38)
Location 1:48577686-48577708 1:48577715-48577737
Sequence CCGGGCACTGCAGAGAGAGAGTC GCATCCAGCAGAGCTGCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 1260} {0: 1, 1: 0, 2: 1, 3: 22, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!