ID: 906791982_906791986

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 906791982 906791986
Species Human (GRCh38) Human (GRCh38)
Location 1:48667142-48667164 1:48667167-48667189
Sequence CCTTTCAAGAGGTGGAGATGTAC CTCTGTCCTTCAGTGTGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96} {0: 1, 1: 0, 2: 6, 3: 81, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!