ID: 906794891_906794898

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 906794891 906794898
Species Human (GRCh38) Human (GRCh38)
Location 1:48689009-48689031 1:48689052-48689074
Sequence CCCATTCAGAAAGAAGATCCATT CTAAAAATACAAAACTTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 332} {0: 1425, 1: 87933, 2: 73848, 3: 45237, 4: 45647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!