ID: 906794892_906794898

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 906794892 906794898
Species Human (GRCh38) Human (GRCh38)
Location 1:48689010-48689032 1:48689052-48689074
Sequence CCATTCAGAAAGAAGATCCATTG CTAAAAATACAAAACTTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 189} {0: 1425, 1: 87933, 2: 73848, 3: 45237, 4: 45647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!