|
Left Crispr |
Right Crispr |
| Crispr ID |
906794895 |
906794902 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:48689041-48689063
|
1:48689094-48689116
|
| Sequence |
CCCCGTCTCTACTAAAAATACAA |
GCCTGCAATCCCAGCCACTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 98173, 1: 216399, 2: 153384, 3: 81062, 4: 60801} |
{0: 45, 1: 2605, 2: 82030, 3: 216545, 4: 249053} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|