|
Left Crispr |
Right Crispr |
| Crispr ID |
906794896 |
906794901 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:48689042-48689064
|
1:48689062-48689084
|
| Sequence |
CCCGTCTCTACTAAAAATACAAA |
AAAACTTAGCTGGGCTGTGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 164005, 1: 210050, 2: 126715, 3: 67031, 4: 60843} |
{0: 2, 1: 15, 2: 130, 3: 490, 4: 1252} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|