ID: 906802570_906802580

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 906802570 906802580
Species Human (GRCh38) Human (GRCh38)
Location 1:48750537-48750559 1:48750586-48750608
Sequence CCAAAGTAAAGCTCACCCTGCAT ACTTCTTTAAGGTGGCAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 135} {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!