ID: 906806940_906806948

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 906806940 906806948
Species Human (GRCh38) Human (GRCh38)
Location 1:48788259-48788281 1:48788300-48788322
Sequence CCTTCTGAGATAATTTCTATTAC CACAGGGTAATGACAAGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 389} {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!