ID: 906806945_906806948

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 906806945 906806948
Species Human (GRCh38) Human (GRCh38)
Location 1:48788287-48788309 1:48788300-48788322
Sequence CCTTTCAGGAGGTCACAGGGTAA CACAGGGTAATGACAAGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 199} {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!