ID: 906814867_906814872

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 906814867 906814872
Species Human (GRCh38) Human (GRCh38)
Location 1:48868304-48868326 1:48868326-48868348
Sequence CCAAGAATGGCTTCCTAAAATTC CTGCTTAAGCAGAAAGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 240} {0: 1, 1: 0, 2: 1, 3: 26, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!