ID: 906815307_906815316

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 906815307 906815316
Species Human (GRCh38) Human (GRCh38)
Location 1:48872838-48872860 1:48872877-48872899
Sequence CCCCCAGGGGCCTAACAGGAAGG AGGAAGAATCACTCTAAACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 303} {0: 1, 1: 0, 2: 2, 3: 15, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!