ID: 906817981_906817990

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 906817981 906817990
Species Human (GRCh38) Human (GRCh38)
Location 1:48898947-48898969 1:48898997-48899019
Sequence CCATGGTACCTCCTTACTCTCAG GATTGCGCTGCTTCCTCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 235} {0: 1, 1: 1, 2: 0, 3: 4, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!