ID: 906821426_906821431

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 906821426 906821431
Species Human (GRCh38) Human (GRCh38)
Location 1:48934381-48934403 1:48934413-48934435
Sequence CCCACTGTGATTATTAATGCTAT CTCTCTAAAGTGAAATTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 250} {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!