ID: 906821970_906821977

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 906821970 906821977
Species Human (GRCh38) Human (GRCh38)
Location 1:48939516-48939538 1:48939560-48939582
Sequence CCTCCAGGAGGGGGAGGAAAGGC CTGGATGTTGATCTGCTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 411} {0: 1, 1: 0, 2: 0, 3: 17, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!