ID: 906837621_906837623

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 906837621 906837623
Species Human (GRCh38) Human (GRCh38)
Location 1:49100893-49100915 1:49100916-49100938
Sequence CCATGCTGCAGATAAGGATGCTG AGGCTTATAAGACTTCAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 483} {0: 1, 1: 0, 2: 0, 3: 1, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!