ID: 906858267_906858270

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 906858267 906858270
Species Human (GRCh38) Human (GRCh38)
Location 1:49331352-49331374 1:49331367-49331389
Sequence CCAGCCACCGGACACAGGGTAGT AGGGTAGTGCCTGCCTCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 66} {0: 1, 1: 1, 2: 6, 3: 35, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!