|
Left Crispr |
Right Crispr |
| Crispr ID |
906870900 |
906870902 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:49479607-49479629
|
1:49479648-49479670
|
| Sequence |
CCATCCATGTCATGCAAAGGACA |
TATAGCTGCACAGCATTTCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 10, 2: 31, 3: 58, 4: 248} |
{0: 1, 1: 4, 2: 94, 3: 1942, 4: 27278} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|