|
Left Crispr |
Right Crispr |
Crispr ID |
906877109 |
906877116 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:49551674-49551696
|
1:49551717-49551739
|
Sequence |
CCATCACCTGTTCCAGTGGAGGT |
TCCATGAGAGTTCTTAGCTTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 45, 2: 157, 3: 279, 4: 505} |
{0: 6, 1: 31, 2: 91, 3: 158, 4: 291} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|