ID: 906896164_906896173

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 906896164 906896173
Species Human (GRCh38) Human (GRCh38)
Location 1:49774438-49774460 1:49774476-49774498
Sequence CCTGTTGAAATATAGTTGTTTAT CTTTATATGGGGCAGGTGGAGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 7, 3: 24, 4: 320} {0: 1, 1: 0, 2: 1, 3: 12, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!