|
Left Crispr |
Right Crispr |
| Crispr ID |
906908198 |
906908201 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:49917951-49917973
|
1:49917967-49917989
|
| Sequence |
CCTAGAAACTGAACAACCTGCTC |
CCTGCTCCTGAATGACTACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 55, 2: 37, 3: 52, 4: 225} |
{0: 6882, 1: 3380, 2: 1919, 3: 1766, 4: 2040} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|