ID: 906940549_906940562

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 906940549 906940562
Species Human (GRCh38) Human (GRCh38)
Location 1:50251756-50251778 1:50251802-50251824
Sequence CCCCACTTCTGCTTCCTTTCCCC ACCTGGCTTTCTGAATGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 909} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!