ID: 906967415_906967421

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 906967415 906967421
Species Human (GRCh38) Human (GRCh38)
Location 1:50472088-50472110 1:50472103-50472125
Sequence CCTATGTTTGGGCTACCGTAGGT CCGTAGGTCTGGAGGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 1, 1: 0, 2: 2, 3: 10, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!