ID: 906988773_906988775

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 906988773 906988775
Species Human (GRCh38) Human (GRCh38)
Location 1:50714724-50714746 1:50714737-50714759
Sequence CCCTTGGAAGATGAATCAAATCC AATCAAATCCTTCTCCTCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 215} {0: 1, 1: 0, 2: 4, 3: 11, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!