ID: 907026414_907026419

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 907026414 907026419
Species Human (GRCh38) Human (GRCh38)
Location 1:51124608-51124630 1:51124635-51124657
Sequence CCCACATTCAATTACATGCAAAT GAGTGGATCAATGCAAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 27, 2: 116, 3: 217, 4: 546} {0: 1, 1: 1, 2: 3, 3: 15, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!