|
Left Crispr |
Right Crispr |
| Crispr ID |
907040165 |
907040168 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:51251762-51251784
|
1:51251781-51251803
|
| Sequence |
CCTCATCTTTACAAAAAATCAAA |
CAAAAGAATTAGCTGGAGCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 212, 2: 3352, 3: 21513, 4: 141590} |
{0: 1, 1: 0, 2: 4, 3: 70, 4: 441} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|