ID: 907049657_907049663

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 907049657 907049663
Species Human (GRCh38) Human (GRCh38)
Location 1:51321647-51321669 1:51321685-51321707
Sequence CCTCTCATACAAGACCTCTGGTT GCACACCCCCTACCCCAACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90} {0: 1, 1: 0, 2: 0, 3: 29, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!