ID: 907051191_907051199

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 907051191 907051199
Species Human (GRCh38) Human (GRCh38)
Location 1:51330668-51330690 1:51330685-51330707
Sequence CCCGCGGCGACCCGCGCTCCCGC TCCCGCACCGCCGGGGGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 230} {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!