ID: 907080184_907080186

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 907080184 907080186
Species Human (GRCh38) Human (GRCh38)
Location 1:51614781-51614803 1:51614802-51614824
Sequence CCTTTGTAGACAGCTACTATTGT GTTACTCACATTTTAAAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 110} {0: 1, 1: 0, 2: 2, 3: 49, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!