|
Left Crispr |
Right Crispr |
| Crispr ID |
907102486 |
907102493 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:51849556-51849578
|
1:51849571-51849593
|
| Sequence |
CCTGTAATCCCGGCACTTTGGAA |
CTTTGGAAGGTGGAGGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 98, 1: 12506, 2: 305838, 3: 263550, 4: 146364} |
{0: 3, 1: 47, 2: 683, 3: 8302, 4: 72824} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|