ID: 907123980_907123987

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 907123980 907123987
Species Human (GRCh38) Human (GRCh38)
Location 1:52033134-52033156 1:52033187-52033209
Sequence CCAGGAGTTCGGGAGAGTAAAAG GAATCCGGAGTCACAAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99} {0: 1, 1: 0, 2: 1, 3: 9, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!