|
Left Crispr |
Right Crispr |
| Crispr ID |
907154083 |
907154088 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:52316311-52316333
|
1:52316327-52316349
|
| Sequence |
CCCCGTCTCTAGTAAACACAAAA |
CACAAAAATTAGCTGGGCTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 29, 2: 670, 3: 11467, 4: 140768} |
{0: 4, 1: 58, 2: 675, 3: 1374, 4: 2644} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|