ID: 907158678_907158685

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 907158678 907158685
Species Human (GRCh38) Human (GRCh38)
Location 1:52356140-52356162 1:52356154-52356176
Sequence CCTGCCCCTCCCTGCCTGGAGCC CCTGGAGCCCCTGTTTCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 156, 4: 1091} {0: 1, 1: 0, 2: 6, 3: 36, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!