ID: 907173144_907173148

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 907173144 907173148
Species Human (GRCh38) Human (GRCh38)
Location 1:52490919-52490941 1:52490948-52490970
Sequence CCACTCTTCTCATTATGAGCACC GCGAAATCTCTTACCTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 156} {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!